Revêtements verre-céramique nanostructurés pour applications orthopédiques - Partie 3


2.2 Force de liaison et microdureté

   La résistance à la traction entre le revêtement et   substrat   était   mesuré   dans   conformité   avec   ASTM   C-633-79.   le   essai   procédure   pouvez   être   a trouvé   dans   notre travail précédent [ 32 ]. Cinq échantillons ont été testés indépendamment   pour   chaque   type   de   revêtements   et   la   résultats   ont été rapportés   comme   moyenne ± écart type

La microdureté des revêtements a été testée sur des surfaces de revêtement polies à l'aide d'un testeur de microdureté Shimadzu (Shimadzu Co., Japon) avec une charge de 300 gf et   une   chargement   temps   de   15 s.   Avant   essai,   revêtements   ont été soumis   à   fin   polissage.   Dureté   valeurs   ont été enregistrés   sur   15   différent   positions.  

le   résultats   sont présentés   comme   signifier ± sd

 


Tableau 1. Amorces utilisées pour les marqueurs liés à la RT-PCR – HOB.


gène

séquence   ( 5 '   - 3 ' )

température de fusion (℃)

GAPDH

F ACCCAGAAGACTGTGGATGG

60


R CAGTGAGCTTCCCGTTCAG


Runx-2

F ATGCTTCATTCGCCTCAC

60


R ACTGCTTGCAGCCTTAAAT


OPN

F TTCCAAGTAAGTCCAACGAAAG

60


R GTGACCAGTTCATCAGATTCAT


collagène de type I

F AGGGTCCCAACGAGATCGAGATCCG

60


R TACAGGAAGCAGACAGGGCCAACGTCG


BSP

F ATGGCCTGTGCTTTCTCAATG

60


R GGATAAAAGTAGGCATGCTTG


 


2.3. Tests de libération d'ions et de minéralisation acellulaire

     Afin de mesurer les comportements de libération des ions des revêtements HT et SP, ils ont été immergés pendant 7 jours dans une solution de chlorure de sodium de 15 ml (pH 7,4) tamponnée avec du tris (hydroxyméthyl) aminométhane et de l'acide chlorhydrique (solution tamponnée HCl –Tris). Après trempage, les valeurs de pH de la solution tamponnée ont été mesurées et les concentrations en ions ont été testées par spectroscopie d'émission atomique par plasma à coupure inductive (ICP-OES, Optima 3000 DV, USA).

La capacité des revêtements à induire la précipitation de composés de Ca et de phosphore (P) a été évaluée en immergeant des revêtements dans un milieu de culture sans cellules. En bref, les revêtements ont été stérilisés par immersion dans une solution à 70% d'éthanol pendant une nuit, puis lavés avec une solution saline tamponnée au phosphate (PBS) avant d'être trempés dans un milieu de culture. Trois millilitres de milieu de culture ont été ajoutés dans chaque puits d'une plaque de culture à 12 puits contenant des échantillons de revêtement. Les échantillons de revêtement ont été incubés à 37 ° C dans une atmosphère humidifiée à 5% de CO 2 pendant 5 h, puis lavés avec de l'eau ultrapure, séchés et pulvérisés au carbone pour l'observation au MEB. La composition chimique des dépôts formés à la surface du revêtement après minéralisation a été analysée par spectroscopie à dispersion d'énergie (EDS), qui a été fixée à l'instrument SEM.


2.4. Isolement et culture d'ostéoblastes humains primaires

La permission d'utiliser des tissus humains mis au rebut a été accordée par le Comité d'éthique humain de l'Université de Sydney et le consentement éclairé a été obtenu. Les ostéoblastes humains primaires (HOB) ont été isolés à partir d'os trabéculaire humain normal comme décrit précédemment [34]. En bref, les os ont été divisés en morceaux de 1 mm3, lavés plusieurs fois dans du PBS et digérés avec de la trypsine à 0,02% (p / v) (Sigma –Aldrich, USA) dans du PBS, pH 7,4, pendant 90 minutes à 37 ° C. Les cellules ont ensuite été cultivées dans un milieu complet contenant un milieu essentiel minimal (a-MEM, Laboratoires Gibco, Etats-Unis), complété avec 10% (v / v) de sérum de veau foetal inactivé par la chaleur (FCS, Laboratoires Gibco), 2 mM. L-glutamine (Gibco Laboratories), tampon Hepes 25 mM (Gibco Laboratories), pyruvate de sodium 2 mM, 30 mg ml -1 de pénicilline, 100 mg ml -1 de streptomycine (Gibco Laboratories) et 0,1 mM de phosphate de magnésium acide L-ascorbique ( Wako Pure Chemicals, Osaka, Japon). Les cellules ont été cultivées à 37 ° C dans une atmosphère contenant 5% de CO 2 et les milieux ont été rafraîchis tous les trois jours. À la confluence, les cellules ont été passées et celles du passage 3 ont été utilisées dans les expériences.



2.5. Attachement cellulaire et observation morphologique

Une fois que les cellules ont atteint une confluence de 80 à 90%, elles ont été transformées en TrypLE Express (Invitrogen), puis centrifugées et mises en suspension dans un milieu complet pour produire une suspension cellulaire de 3,4 × 10 4 cellules par millilitre. Ensuite, une suspension cellulaire de 1 ml a été ajoutée dans chaque puits d'une plaque de culture cellulaire à 24 puits contenant des échantillons de revêtement. Après culture pendant 2, 5 et 24 h, les cellules ont été fixées dans une solution à 4% de paraformaldéhyde, post-fixées à l'aide de 1% de tétroxyde d'osmium dans du PBS pendant 1 h, puis déshydratées dans une série de solutions d'éthanol classé (30, 50, 70, 90, 95 et 100%) et finalement séché dans de l'hexaméthyldisilizane pendant 3 min. Les échantillons de revêtement séchés ont été pulvérisés à l'or avant l'observation au MEB.



2.6 Test de prolifération cellulaire

Le test aqueux CellTiter 96 (Promega, USA), une méthode colorimétrique, a été utilisé pour déterminer le nombre de cellules viables. Le test consiste en une solution combinée de composé 3- (4,5-diméthylthiazol-2-yl) -5- (3-carboxyméthoxyphényl) -2- (4-sulfophényl-2H-tétrazolium) (tétrazolium) (tétrazolium) et un réactif de couplage électronique (méthosulfate de phénazine) avec un rapport volumique de 20: 1. Le premier composé peut être bioréduit par des cellules viables en un formazan soluble dans le milieu de culture cellulaire. Ainsi, l’absorbance du formazan à 490 nm est directement proportionnelle au nombre de cellules viables. Quatre échantillons de chaque type de revêtements ont été testés pour chaque point temps et les disques Ti-6Al-4V non revêtus ont été utilisés comme contrôle. En bref, 1 ml de suspension cellulaire ayant une densité cellulaire de 8,5 x IO4 ml ml -1 a été ajouté dans chaque puits d'une plaque de culture à 24 puits contenant les échantillons de revêtement. Au bout de 3 et 7 jours, le milieu de culture a été remplacé par 700 ul de la solution de travail MTS, qui était une solution cinq fois diluée du dosage aqueux CellTiter 96 dans du PBS. Après 4 h d'incubation supplémentaire, 100 ml de la solution de travail ont été transférés sur une plaque de culture cellulaire à 96 puits pour mesurer l'absorbance à l'aide d'un lecteur de microplaques (PathTech) à 490 nm.


2.7 Réaction en chaîne par polymérase quantitative en temps réel

Les HOB ont été ensemencés sur les échantillons de revêtement à une densité cellulaire de 2x10 4 cellules cm -2 et cultivés pendant 1 jour et 7 jours. Après chaque point temps, l'ARN total a été isolé d à partir de HOB cultivés sur des échantillons de revêtement et des échantillons témoins de disques de Ti-6Al-4V non revêtus en utilisant du Trizol (Sigma) en suivant les instructions du fabricant. L'ADNc du premier brin a été synthétisé à partir de 0,7 µg d'ARN total en utilisant le kit Omniscript RT (Qiagen, USA) conformément aux instructions du fabricant. L’ADNc a ensuite été analysé par PCR en temps réel (Rotor-Gene 6000, Corbett Life Science) pour identifier les gènes liés aux ostéoblastes: Runx-2, collagène de type I, ostéopontine (OPN) et sialoprotéine osseuse (BSP) et leur expression génique relative. les taux ont été obtenus en normalisant la glycéraldéhyde 3-phosphate déshydrogénase (GAPDH).

Les amorces utilisées pour les gènes sélectionnés sont énumérées dans le tableau 1.


2.8. analyses statistiques

Les données ont été obtenues à partir de quatre expériences indépendantes et exprimées en moyenne ± écart-type. Pour l' analyse statistique , le programme SPSS 17.0 a été utilisé. Le test de Levene a été réalisé pour déterminer l'homogénéité de la variance pour toutes les données, puis des tests post-hoc de Tukey HSD ont été utilisés pour les données avec une variance homogène, sinon le T2 post-hoc de Tamhane a été utilisé.

Une valeur p inférieure à 0,05 a été considérée comme significative.



******à suivre******